Background
Breast cancer is the leading diagnosed cancer in women and ranks the top incidence among all cancers. It is reported that up to 83% of breast cancer patients have received radiotherapy (RT) [
1]. However, data over the last decade have shown that RT inevitably induces the immunosuppressive tumor microenvironment (TME), which in turn aggravates the incidences of radiotherapy resistance [
2].
In the TME, transforming growth factor beta 1 (TGF-β1) is an immunosuppressive cytokine that plays an important role in the differentiation and development of Treg population [
3‐
5]. Although the clinical data have shown that the local TGF-β1 levels in tumors would significantly increase after radiotherapy [
6], it is surprising that no fluctuation of peripheral TGF-β1 has been observed [
7,
8]. These findings indicate a distinct form of TGF-β1 in the breast cancer tissues that contribute to the local accumulation of TGF-β1. Traditionally, TGF-β1 is known to be secreted as latency-associated peptide-TGF-β1 (L-TGF-β1), which needs to be released from its binding proteins to form free TGF-β1 before it binds TGF-β1 receptor (TGF-βR) to activate downstream signaling pathways [
9]. Recent studies, however, have revealed that, with the help of integrin ανβ8, TGF-β1 can expose the active site and binds directly to TGF-βR in its precursor form [
10]. Moreover, a third form of TGF-β1 has been found as the extracellular vesicle (EV) associated-TGF-β1 (here after referred as TGF-β1
EV) [
11,
12]. In contrast to free TGF-β1 or L-TGF-β1, the functional TGF-β1
EV can transmit signals rapidly and effectively through endocytosis [
13]. We then suppose that the elevated intratumoral TGF-β1 post-radiotherapy are associated with EVs, which cannot effectively diffuse into blood circulation due to their relatively large sizes [
14].
Despite RT has been thought to promote anti-tumor immunity [
15,
16], it is also reported to induce of Treg differentiation by increasing the intratumoral TGF-β1 level within the TME [
17,
18]. As a major immunosuppressive regulator, the recruitment and accumulation of Tregs within TME undermines spontaneous T cell activation [
19], resulting in higher risks of tumor aggressiveness, recurrence, and metastasis [
20], as well as the induction of resistance to radiotherapy, and finally patients’ shorter survival [
9‐
13]. Thus, TGF-β1 has been considered to be an endogenous factor for the development of RT resistance [
21]. However, it is still unknown whether RT induced-TGF-β1 is in EV-associated form. Therefore, understanding the existing form of TGF-β1 and the immunosuppressive mechanisms of TGF-β1
EV in the radiated tumors could shed light on overcoming radiotherapy resistance.
Our previous work has shown that a natural flavonoid, naringenin is capable to reduce TGF-β1 secretion from breast cancer cells through inhibiting phosphorylation levels of PKCs [
22]. In the present study, it is of strong necessity to explore whether naringenin exerts the same effect on reducing the secretion of TGF-β1
EV in the radiated tumors. As distinct PKCs have been reported to play different roles in the process of vesicles secretion in various kinds of cells [
23‐
26], specific types of PKCs may regulate the secretion of TGF-β1
EV in breast cancer cells. We used a murine triple negative breast cancer model to demonstrate that irradiation promoted the release of TGF-β1 from the cancer cells, and a large proportion of the secreted TGF-β1 was in the extracellular vesicle-associated form.
Excitedly, we found that the expression of PKC-ζ was preferentially enhanced by irradiation and the blockage of PKC-ζ restricted the TGF-β1EV secretion, indicating that PKC-ζ contributed to the releasing of TGF-β1EV. More importantly, naringenin, but not 1D11, significantly improved the radiotherapy efficacy with low side effects. The underlying mechanism of naringenin was via downregulating of the superoxide-Zinc-PKC-ζ-TGF-β1EV pathway activated by radiation. Therefore, targeting PKC-ζ to counteract TGF-β1EV function could represent a novel strategy to overcome radiotherapy resistance in the treatments of breast cancers or other cancers.
Materials and methods
Experimental animal and cell lines
Female BALB/c (6–8 weeks old) were purchased from Vital River Laboratory Animal Technology (Beijing, China). Foxp3-GFP mice were kindly provided by Prof. Yangxin Fu (University of Texas, Southwestern Medical Center, Texas, USA). All animal experiments were performed according to the institutional ethical guidelines on animal care and the protocols used for this study were approved by the Animal Care and Use Committee at the Institute of Biophysics, Chinese Academy of Sciences. Murine breast cancer 4T1 cell line was obtained from ATCC and cultured in 5% CO2 and maintained in RPMI 1640 medium supplemented with 10% FBS (VivaCell, Isreal) 100 U/ml penicillin, and 100 mg/ml streptomycin.
Exocellular vesicles purification
For in vitro experiment, 4T1 cells were cultured in RPMI 1640 media supplemented with 10% EV-depleted FBS. Supernatant was collected and centrifuged at 500 g for 10 min followed by a step of 3000 g for 20 min at 4 °C to pellet cells and debris. The supernatant was collected without disturbing the cell/debris pellet and was transfered to an ultracentrifuge tube. Then the supernatant was centrifuged at 100,000 g for 70 min at 10 °C and the EV pellets were collected. The pellets were resuspended in a small volume of PBS. For tumor tissues, the harvested tumors were dissected and cut into small pieces, followed by culture in RPMI 1640 media supplemented with 10% EV-depleted FBS for 48 h. Supernatant of tumor pieces was collected for the EVs purification. The EVs was characterized by Transmission Electron Macroscopy (FEI, Tecnai Spirit, 120 kV, USA) and quantified by BCA protein assay kit.
TGF-β1 detection by ELISA
TGF-β1 in supernatant or EV was detected by ELISA (DY1679, R&D Systems, Minneapolis, MN). In brief, the 96-well microplate was coated with the Capture antibody overnight at 4 degree. Cells were washed by filling each well with Washing buffer. The plate was blocked by Block buffer for 1 h. TGF-β1 was activated by HCl and added to each well and incubate 2 h at room temperature. Cells were washed and the detection antibodies were added and incubated for 2 h. Streptavidin-HRP was added to each well. Washing wells and adding Substrate solution to each well were followed by adding Stop solution. The optical density of each well was determined immediately at 450 nm.
Data sources and processing
The gene mRNA expression matrix and clinical follow-up information of Breast Invasive Carcinoma patients with information of radiation therapy were obtained from the cBioPortal database (
http://www.cbioportal.org). The association between TGF-β1 expression and the overall survival was determined using the Kaplan–Meier survival analysis with the 'survival' package (version 4.1.2) in R statistics software, and the Log-rank test was used to detect significant differences. Immune cell infiltration was obtained from the ImmuCellAI database (
http://bioinfo.life.hust.edu.cn/ImmuCellAI#!/) and the clinical information was also acquired from the cBioPortal database by using the patient ID.
Western blot
Cells were lysed by RIPA lysis buffer and the protein concentration was determined by BCA protein assay. Cell lysates were separated by SDS-PAGE gels and transferred to nitrocellulose membranes. The membranes were then blotted with the indicated antibodies (anti-TGF-β1 antibody, ab179695; anti-PKCζ antibody, ab108970; anti-p-PKCζ antibody, ab76129; anti-β-actin antibody, ab8226. Abcam, Cambridge, UK).
PMA and CAL treatment
Phorbol myristate acetate (PMA) and Calphostin C (CAL) were purchased from Merck and used at the indicated concentrations. 4T1 cells were treated by PMA or CAL for 48 h. Supernatant was collected and EV was purified.
guideRNA sequence
gRNA1-F | 5′–caccGTCCTACAAATAGGACGTGC-3′ |
gRNA1-R | 5′–aaacGCACGTCCTATTTGTAGGAC–3′ |
gRNA2-F | 5′–caccgCGACCCACGTAGTAGACGAT–3′ |
gRNA2-R | 5′–aaacATCGTCTACTACGTGGGTCGc–3′ |
TGF-β1 knockout of 4T1 cell line generation
gRNA targeting sequence were designed as the sequences described above using CRISPR design tool (
https://zlab.bio/guide-design-resources) and the sgRNA oligos with BbsI restriction site were prepared by annealing. The gRNA oligos were constructed into pX458M and EZ-Guide plasmids, respectively. Digest pX458M-gRNA1 and EZ-Guide-gRNA2 plasmid using XhoI and HindIII Restriction Enzyme (New England Biolabs, Beijing, China) and the two plasmids were ligated by T4 DNA ligase. pX458M-gRNA1 + gRNA2 plasmid were transformed into 4T1 cells by Lipofectamine 3000 Reagent (Thermo Fisher Scientific, Waltham, MA). After 48 h transfection, GFP + cells were sorting into 96-well plate by FACS Influx (BD, Franklin Lake, NJ) and cells were identified by qPCR for TGFB mRNA and ELISA for TGF-β1 protein.
Quantitative real-time PCR (qPCR) assay
Total RNA was isolated from cells by Trizol (Invitrogen, Carlsbad, CA). The mRNA was reversely transcribed to cDNA by M-MLV reverse transcriptase (Invitrogen, Carlsbad, CA). qPCR was performed using SYBR Green qPCR SuperMix (Invitrogen, Carlsbad, CA) to detect the expression of TGF-β1 and PKCs mRNA. Gene expression was normalized to GAPDH expression and presented as fold-change compared to the Control experiment.
Primer sequence
TGF-β1-F | TCGACATGGATCAGTTTATGCG |
TGF-β1-R | CCCTGGTACTGTTGTAGATGGA |
Prkca-F | GTTTACCCGGCCAACGACT |
Prkca-R | GGGCGATGAATTTGTGGTCTT |
Prkcb-F | GTGTCAAGTCTGCTGCTTTGT |
Prkcb-R | GTAGGACTGGAGTACGTGTGG |
Prkcc-F | CTCGTTTCTTCAAGCAGCCAA |
Prkcc-R | GTGAACCACAAAGCTACAGACT |
Prkcd-F | CCTCCTGTACGAAATGCTCATC |
Prkcd-R | GTTTCCTGTTACTCCCAGCCT |
Prkce-F | GGGGTGTCATAGGAAAACAGG |
Prkce-R | GACGCTGAACCGTTGGGAG |
Prkcq-F | TATCCAACTTTGACTGTGGGACC |
Prkcq-R | CCCTTCCCTTGTTAATGTGGG |
Prkci-F | CTTTGCAGTGAGGTTCGAGAT |
Prkci-R | AGCCTCTTCTAACTCCAACTGAG |
Prkch-F | TCCGGCACGATGAAGTTCAAT |
Prkch-R | TACGCTCACCGTCAGGTAGG |
GAPDH-F | AGGTCGGTGTGAACGGATTTG |
GAPDH-R | TGTAGACCATGTAGTTGAGGTCA |
Coculture of EVs and naïve splenocytes
Anti-CD3 antibody was coated into 96-well U plate overnight. Naïve splenocytes were added into each well. EVs were isolated from cells treated by different reagents and quantified by BCA protein assay. Different EVs were diluted by same times and added to naïve splenocytes with anti-CD28 antibody. After 72 h, cells were collected, stained with fluorescent antibodies and detected by Flow cytometry.
Immunohistochemistry
Immunohistochemical studies were done in 5-µm sections of paraffin-embedded tumor tissues using antibodies for TGF-β1 to determine its content in the tumors. The slides were incubated in citrate buffer for 20 min in a steamer and endogenous peroxidase was blocked by incubation with 3% H2O2 for 20 min at room temperature. The anti-TGFβ1 antibody (ab179695, Abcam, Cambridge, UK) was used in a dilution of 1:500. The slides were then stained with the secondary antibody in a dilution of 1:500. To determine the protein expression, stained slides were examined under fluorescence microscopy.
PKC-ζ siRNA
4T1 cells at 80% confluence were transfected with siRNA (sc-36254, Santa Cruz) by Lipofectamine 3000 Reagent (Thermo Fisher Scientific, Waltham, MA) for 24 h. Cells were treated by PMA or radiation for indicated time.
Treg differentiation assay
Spleen of GFP-Foxp3 transgenic BALB/c mice was harvested and single cell suspension was prepared. Cells were treated with anti-CD3ε/CD28 function antibody and EV or TGF-beta1 or 1D11 (BE0057, InVivoMab, West Lebanon, NH) for 72 h. Percentage of CD4+GFP+ cells in CD4+ cells was detected by BD FACSCalibur.
Structure analysis
The following putative structures of mouse PKCs were downloaded from the AlphaFold Protein Structure Database (
https://alphafold.ebi.ac.uk/ and used in our study: KPCA (UniProtKB: P20444), KPCB (UniProtKB: P68404), KPCD (UniProtKB: P28867), KPCE (UniProtKB: P16054), KPCG (UniProtKB: P63318), KPCI (UniProtKB: Q62074), KPCL (UniProtKB: P23298), KPCT (UniProtKB: Q02111), KPCZ (UniProtKB: Q02956). Geometrical alignments, as well as visualization, were performed with PyMOL version 2.1.0.
Zinc-specific fluorescence staining
Before radiation administration, 4T1 cells were treated with Naringenin of 200 uM concentration for 30 min. X-Ray of 2, 4 or 8 Gy dose was used to treat 4T1 cells, respectively. After 2 h, cells were collected and washed with PBS 3 times. TSQ was dissolved in Lock’s buffer (pH 7.4) and cells were stained with 150 nM TSQ for 1 min. After 3 times washing, cells were added into 96-well plate and were examined under a fluorescence microplate reader (Excitation, 345 nm; Emission 495 nm) (SpectraMax M4 Multi-Mode Microplate Reader, Molecular Devices, San Jose, CA). The instrument measures the intensity of the reradiated light and expresses the result in Relative Fluorescence Units (RFU) using SoftMax Pro Software (Standard Edition 7.1).
Animal model
4T1 cells were subcutaneously injected at 5 × 104 cells per mouse. Mice were randomized to treatment groups. Radiotherapy was administrated with a dose of 10 Gy when tumor volume reached 70–80 mm3. 100 mg/kg naringenin was administrated daily by intragastric administration for 30 days. 5 mg/kg 1D11 was injected intraperitoneally 3 times per week for 3 weeks. Tumor volumes were measured twice a week and calculated as length*width*height/2. The survival days of tumor-bearing mice were recorded. All animal experiments were performed according to the institutional ethical guide lines on animal care and the protocols used for this study were approved by the Animal Care and Use Committee at the Institute of Biophysics, Chinese Academy of Sciences.
Flow cytometry and antibodies
Single-cell suspensions were prepared. Samples were stained (20–30 min) with the following antibodies: anti-CD45, anti-CD3, anti-CD4, anti-CD8α, anti-CD25 antibodies. For intracellular staining, cells were fixed, permeabilized overnight at 4 °C (Fixation/Permeabilization Concentrate and Diluent kit, eBioscience, San Diego. CA) and subsequently stained using anti-Foxp3 antibody for 30 min. All experiments were performed on BD FACSCalibur or BD LSRFortessa and data was analyzed with FlowJo 7.6.1.
Statistical analysis
Student’s t test was used for comparisons of datasets with two groups. For multiple comparisons, we used type II ANOVA with correction of statistical hypothesis testing. Statistical significance was considered reached for p values < 0.05. Survival was analyzed by Log-rank (Mantel-Cox) test.
Discussion
Although RT is widely applied to breast cancer patients, radiotherapy resistance is inevitable, presented as the tumor recurrence and poor prognosis. Here we demonstrated that the irradiation preferred to induce an elevated expression and phosphorylation level of PKC-ζ within the TME, resulting in the resistance to radiotherapy by promoting the TGF-β1EV secretion. An effective way to intervene the TGF-β1EV release from breast cancer cells was first put forward in this study.
In clinic, an elevated TGF-β1 level induced by irradiation has been frequently found accumulation in tumor tissues but not in the circulating system [
8], suggesting the TGF-β1 is mainly associated with EVs. Not only in breast cancers of mice, but also in human NSCLC tissues, large proportion of TGF-β1 was found associated with the EVs. The fact indicates that TGF-β1 in other types of human cancers may exist in a similar form, which makes the TGF-β1
EV widely adapted for other cancers as a promising biomarker. It shows that the high level of intra-tumoral TGF-β1 is usually accompanied with the poor prognosis. Therefore, the TGF-β1
EV can also be used as a tumor tissue biomarker to personalize radiation therapy for breast cancers.
Different inhibitors targeting the TGF-β1 pathway have been developed to synergize with radiotherapy in clinical trials, however, the combinational treatments are sometimes with limited efficacies and even less effective outcomes [
32]. Here we demonstrated that RT treatment effectively controlled tumor growth but promoted more TGF-β1
EV release. Different to the free form TGF-β1, the TGF-β1
EV can be endocytosed by receipt cells and transmit intracellular signaling effectively. The failure of the TGF-β1 antibody for the TGF-β1
EV blockage possibly resulted in the low efficiency to overcome the TGF-β1
EV mediated immunosuppression. Therefore, selective inhibition of the TGF-β1
EV release is a promising combination therapeutic strategy for preventing breast cancer progression.
PKC family members are reported to be activated early upon irradiation [
33]. Our data provide the further evidence on the importance of superoxide activating PKC-ζ for the TGF-β1
EV release, and how naringenin intervene in this process. Although further studies are still needed to determine how naringenin regulates oxidation, our data suggest that naringenin may transform the O2˙- induced by radiation to a non-toxic form, such as H
2O
2 [
34], and maintain the killing ability of oxidation to tumors. In the study, we demonstrated that irradiation induced a significant increase of PKC-ζ expressions on three levels, including the level of transcription, translation and phosphorylation. Naringenin, however, could block radiotherapy-induced PKC-ζ only on the phosphorylation level to enhance tumor control (Figs.
5A–D and
7). The data indicated that the phosphorylation level of PKC-ζ was particularly important in controlling the release of TGF-β1
EV.
Preciously, we have demonstrated that naringenin inhibits TGF-β1/Smad3 signaling pathway via the decrease of smad3 expression and can directly block receptor interaction [
35,
36], leading to the reduction of Tregs production. Naringenin (YPS345) has been proved to effectively relieve radiation induced pulmonary inflammation and fibrosis [
37], which is currently in an ongoing phase II clinical trial in China (NO. CTR20212450). Based on the evidence that naringenin could relieve RT induced toxicity and improve the effectiveness, naringenin is expected to elevate the radiation dose necessary for killing tumors, meanwhile minimizing the side effects of irradiation and overcoming the radiation therapy resistance via the TGF-β1
EV intervention. In summary, our data substantiate naringenin to be a promising candidate for the development of potential anti-TGF-β1 agents to overcome radiotherapy resistance.
Open AccessThis article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit
http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (
http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.