STAT5 is activated in macrophages by breast cancer cell-derived factors and regulates macrophage function in the tumor microenvironment

Csf1r-iCre mice (Jackson Laboratories) and Stat5^fl/fl mice [generated by Dr. Lothar Hennighausen [28], obtained from Dr. Michael Farrar, University of Minnesota] were backcrossed to the BALB/c background, which was verified using congenic analysis (IDEXX-RADIL, Columbia, MO). STAT5^fl/fl and Csf1r-iCre mice were crossed to generate conditional knockout mice (STAT5^cKO). Wild-type (WT) BALB/c mice were purchased from Envigo. All experiments were performed with 6- to 8-week-old female mice and all animal care and procedures were approved by the Institutional Animal Care and Use Committee of the University of Minnesota and in accordance with the procedures detailed in the Guide for the Care and Use of Laboratory Animals [29].

HC11 [30] and HC11/R1 cells were obtained from Jeffrey Rosen, Baylor College of Medicine, Houston, TX, and maintained as described previously [31]. To generate a cell line with enhanced take rate and metastatic propensity, HC11/R1 cells were injected into the mammary fat pad and primary tumors were harvested. Tumor cells were enriched for in culture by incubating in HC11 medium containing 2 mg/mL puromycin. Resulting cell lines were then injected into mammary fat pads of naïve mice and assessed for primary tumor formation and metastasis. The HC11/R1-LM cell line was identified based on its ability to metastasize to the lung following in vivo passage [32]. 4T1 cells were obtained from Thomas Griffith, University of Minnesota, Minneapolis, MN and grown in media containing RPMI, 10% FBS, 1% penicillin/streptomycin (Life Technologies), 1% L-glutamine (Life Technologies), 10 mM HEPES (Life Technologies), 1 mM sodium pyruvate (Life Technologies) 200 µg/mL G418. Human breast cancer and epithelial cell lines and THP-1 cells were obtained from and maintained in accordance with ATCC recommendations. Mouse BMDMs were maintained according to published protocols [33]. Human primary macrophages were derived from PBMCs isolated from Trima Cones obtained through the Memorial Blood Center, Minneapolis, MN. PBMCs were subjected to CD14 + enrichment via CD14 + microbeads (Miltenyi Biotec) through MACS LS columns (Miltenyi Biotec) and differentiated into macrophages with recombinant M-CSF (BioLegend) in RPMI supplemented with 10% FBS and 1% penicillin/streptomycin on days 1 and 5 (Day 5 treatment with 2X M-CSF) following CD14 + enrichment. All cells were grown at 37 °C and 5% CO2 and regularly checked for mycoplasma contamination. Serum-starved HC11, HC11/R1, and HC11/R1-LM cells were treated with 30 nM B/B (Clontech) or vehicle (ethanol) for 24 h, and conditioned media was collected, filtered, and used to stimulate BMDMs. 4T1 cells were serum-starved for conditioned media which was used to treat BMDMs. THP-1 cells were differentiated into macrophages with 5 ng/mL phorbol 12-myristate 13-acetate (PMA) overnight. Conditioned medium (CM) collected from serum-starved breast cancer cell lines was spun down to eliminate cellular debris and used to stimulate differentiated THP-1 or primary human macrophages that were serum-depleted in 1% FBS in DMEM for 4 h prior to CM exposure. In experiments neutralizing GM-CSF, rat anti-mouse GM-CSF (BioTechne) was incubated with tumor cell CM at a concentration of 2.5 µg/mL for 1 h at 37 °C prior to treatment of BMDMs. Normal mouse IgG (Santa Cruz) and no treatment were controls incubated with tumor cell CM prior to BMDM stimulation. BMDMs were stimulated with 4T1 CM for 24 h, media was replaced with fresh serum-free media for an additional 24 h to collect soluble factors from the STAT5^fl/fl and STAT5^cKO TAMs and referred to as STAT5^fl/fl DCM (double conditioned-media) and STAT5^cKO DCM, respectively. For non-contact co-culture experiments, 4T1 tumor cells were cultured in the bottom of a six-well plate along with STAT5^fl/fl or STAT5^cKO BMDMs plated in a 0.4 µm hanging insert to allow for soluble factor exchange.

BMDMs were seeded at 2500 cells per 24-well 0.8 µm hanging insert in DMEM10 media and incubated overnight while 4T1 cells were starved in serum-free media. BMDMs in inserts were starved for 4 h prior to the addition of 1 × 10⁴ 4T1 cells. As controls, 4T1 cells were seeded alone. Six hundred microliters of RPMI-1640 medium containing 1% FBS was added to the lower chamber of the 24-well plate. After 20 h, cells on the apical side of the top chamber were removed with a cotton swab, inserts washed in PBS, then fixed with methanol for 10 min at − 20 °C. Cells which migrated to the lower side of the membrane were adhered to slide, coverslipped with DAPI and counted under a fluorescence microscope.

Cells were lysed in RIPA buffer containing protease inhibitors and protein lysates were subjected to SDS–PAGE and immunoblot analysis as previously described [34]. Antibodies used include pSTAT5 (Cell Signaling #9314, 1:1000), total STAT5 (Cell Signaling #9363, 1:1000), β-tubulin (Cell Signaling # 2146S, 1:1000), pFAK Y397 (Cell Signaling, # 3283S, 1:1000), and total FAK (Cell Signaling #3285S, 1:1000).

RNA for qRT-PCR was extracted from cells using TriPure trizol (Roche) and cDNA was prepared using the qScript cDNA synthesis kit (Quanta Biosciences) according to the manufacturers’ protocols. qRT-PCR was performed using PerfeCTa SYBR Green (Quanta Biosciences) and the Bio-Rad iQ5 system. The 2^−ΔΔCt method was used to determine relative quantification of gene expression and normalized to cyclophilin B (CYBP). Primer sequences: Human GMCSF: Fwd- CGTCTCCTGAACCTGAGTAGA, Rev- TGCTGCTTGTAGTGGCTG G. Mouse GMCSF: Fwd- GGCCTTGGAAGCATGTAGAGG, Rev- GGAGAACTCGTTAGAGACGACTT; Col1a1: Fwd– GACGCCATCAAGGTCTACTG, Rev- ACG GGA ATC CAT CGG TCA; Col5a2: Fwd- CAGAAGCCCAG ACGTATCG, Rev- GGTGGTCAGGCACTTCAGAT; Vegfa: Fwd- ACGTCAGAGAGCAACATCACC, Rev- CTTTGT TCT GTC TTT CTT TGG TCT G; Gpx1: Fwd- ATGTCGCGTCTCTCTGAGG, Rev- CCGAACTGATTGCACGGGAA; Bcl6: Fwd- CCGGCTCAATAATCTCGTGAA, Rev- GGTGCATGT AGAGTGGTGAGTGA.

Breast cancer cell CM samples were collected and used to perform a human GM-CSF DuoSet ELISA (R&D Systems). Murine tumor cell CM was used to perform mouse GM-CSF ELISA (R&D Systems). STAT5^fl/fl DCM and STAT5^cKO DCM was subjected to mouse Type I Collagen ELISA (Novus Biologicals). All ELISAs were performed according to the manufacturer’s instructions.

Total RNA was collected using TriPure reagent (Roche) from primary human STAT5^fl/fl and STAT5^cKO BMDMs treated with DMEM, 20 ng/mL rmGM-CSF (Fisher Scientific), or 4T1 CM. Samples were submitted in biological triplicate to the University of Minnesota Genomics Center for quality control, library creation, and next-generation sequencing. Due to quality control, one biological replicate was removed from the STAT5^fl/fl BMDM submissions. Sequencing data have been deposited in the gene expression omnibus (GEO) GSE171428.

Bulk RNAseq samples were processed and aligned using the CHURP version 0.2.2 command line interface framework. A full description of the CHURP pipeline can be found in Baller et al. [35]. Briefly, trimmomatic version 0.33 was used to clean reads for adapter contamination and low-quality sequence, and FastQC was used to generate sequence quality reports for raw and trimmed reads [36]. HISAT2 version 2.1.0 was used to align samples to the genome reference consortium mouse build 38 reference genome [37]. featureCounts v1.6.2 was used to count mapped reads to genes [38]. M. musculus GRC build 38.99 gft file was used.

All differential gene expression and pathway analyses were done in R v 3.6.3 (R Core Team, 2020). Differential gene expression analysis was done in EdgeR v 3.28.1 [39]. Differentially expressed genes were identified between wild-type and Stat5 knockout samples for each treatment (DMEM, 4T1-CM and GM-CSF). Counts were normalized using the relative log expression normalization method and only genes with counts per million greater than one in two or more samples were kept. A general linear model approach was used to test for differentially expressed genes between wild-type and knockout samples for each treatment. A gene was categorized as differentially expressed if the p value was less than 0.01 after p value adjustment. P values were adjusted using the Benjamini & Hochberg method and there was no minimum log fold change required. GO term enrichment analysis and gene set enrichment analysis (GSEA) were done using the ClusterProfiler R package [40]. The hallmark gene set from the Molecular Signatures Database v 7.1 (https://​www.​gsea-msigdb.​org/​gsea/​msigdb/​index.​jsp) was used for the GSEA analysis. Human gene orthologs of mouse genes were obtained from the Mouse Genome Informatics website (http://​www.​informatics.​jax.​org/​downloads/​reports/​HMD_​HumanPhenotype.​rpt).

Breast cancer cells were serum-starved for 24 h and conditioned medium samples were collected and spun at 1000 xg for 15 min at 4 °C. BSA in PBS was then added to each sample for a final concentration of 0.5%. Each sample was then transferred to a clean eppendorf tube and spun at 10,000 × g for 10 min at 4 °C, after which the supernatants were used for ELISA. Murine tumor cells were serum-starved for 24 h and conditioned media samples were collected and spun to eliminate cellular debris. BMDMs were stimulated with 4T1 CM for 24 h, media was replaced with fresh serum-free media for an additional 24 h to collect STAT5^fl/fl DCM and STAT5^cKO DCM.

All images were taken on a Leica DM400B microscope at either 20 × or 40 × objectives. Images were acquired using a Leica DFC310 FX camera and LAS V3.8 software and processed in ImageJ. 3 images per lung were analyzed for metastasis.

For immunofluorescence analysis, frozen OCT tumors were sectioned 5-μm-thick prior to staining. For paraffin embedded sections, tumors were fixed in 4% PFA and paraffin embedded. Lungs were inflated with 500µL of 2% PFA and fixed before paraffin embedding. Five-micrometer-thick sections were stained with hematoxylin and eosin (H&E).

For BALB/c mice tumor induction, 1 × 10⁴ HC11/R1-LM cells or 4T1 cells in 50% Matrigel (BD Biosciences) were injected into the inguinal mammary fat pads of 6-week-old mice. All mice receiving HC11/R1-LM tumors received 1 mg/kg B/B Homodimerizer (Clontech), intraperitoneally, twice weekly. For co-injections studies, BMDMs were treated with 4T1 CM for 24 h. CM-treated BMDMs were then harvested and injected at a ratio of 1:4 with 4T1 tumor cells. All mice were examined for tumor development by palpation and considered tumor-bearing once tumor size reached ∼100 mm³. Researchers were blinded to mouse genotype and co-injection group during data collection and analysis. Tumor volume was calculated using the following equation: V = (L × W2)/2. Mice were euthanized when tumors reached 1 cm³ and survival was recorded as number of days from surgery (Day 0) until tumor size endpoint.

At endpoint, lungs or tumors were harvested, minced, and digested in 1 mg/mL Collagenase D (Roche) containing 15 μg/mL DNaseI (Sigma-Aldrich) at 37 °C with shaking for 45–60 min. Following digestion, tissues were further homogenized through a 70 μm cell strainer and pelleted by centrifugation at 500 g. Red blood cells were lysed in ACK Buffer (150 mM ammonium chloride, 10 mM potassium chloride, 0.1 mM sodium EDTA, pH 7.4) and cells were resuspended in FACS Buffer (2% FBS and 1 mM EDTA in PBS). Macrophages were isolated using the Miltenyi F4/80 positive selection MACS beads (130-110-443) and lysed in RIPA buffer prior to immunoblot analysis. For flow cytometry analysis, cells were stained in an antibody master mix including fixable viability dye (eBioscience) and anti-CD16/CD32 (eBioscience, clone 93) at room temperature protected from light. Following surface antibody staining, samples were fixed in 2% paraformaldehyde (PFA) for 1 hour at room temperature. Cells were washed and permeabilized in 1 × Flow Cytometry Permeabilization Buffer (Tonbo) for 5 min, followed by incubation with intracellular antibodies in this buffer for 30 min at room temperature. Following a wash and centrifugation, cells were incubated with streptavidin-APC (eBioscience) for an additional 15 min at room temperature. Antibodies used include: CD45 (BD Biosciences, clone 30-F11), Ly6G (BioLegend, clone 1A8), CD64 (BioLegend, clone X54-5/7.1), MerTK (R&D Systems, polyclonal #BAF591, biotinylated). CountBright Absolute Counting Beads (Life Technologies) were used for cell number calculations. Samples were collected using a LSR Fortessa X-20 cytometer (BD Biosciences) and analyzed using FlowJo Software.

Statistical analysis was performed using Student’s unpaired, two-tailed t test. Comparisons between at least three groups was performed using one-way ANOVA with Tukey’s multiple comparison test. Overall survival data were summarized using Kaplan–Meier curves and compared by treatment groups using log-rank tests (GraphPad PRISM v9). Error bars represent standard error of the mean (SEM). P values < 0.05 were considered statistically significant.

JAK/STAT signaling is an important oncogenic pathway in both tumor and stromal cells [16, 17, 41‐46]. While STAT1, STAT3, and STAT6 have been previously linked to TAM function [11, 12, 47], little is known regarding the function of STAT5 in TAMs. To determine whether tumor cells produce soluble factors that activate STAT5 in vitro, conditioned medium (CM) samples were collected from estrogen receptor positive (ER +) (T47D, MCF7, BT-474, ZR751), human epidermal growth factor receptor 2 (HER2 +) (BT-474, SKBR3), and TNBC (Hs578T, MDA-MB-231, MDA-MB-468, BT-549) cells. Soluble factors from serum-starved TNBC, but not ER + or HER2 + , cell lines induced STAT5 phosphorylation (pSTAT5) in THP-1 macrophages and peripheral blood mononuclear cell (PBMC)-derived macrophages (Fig. 1A, B). We also assessed the ability of murine mammary tumor cell lines to activate STAT5 in macrophages. 4T1 cells represent a well-characterized BALB/c-derived model of TNBC that efficiently metastasize to the lung following orthotopic injection [48]. To confirm these findings using an additional model, further studies were performed using a panel of cell lines derived from the immortalized, non-transformed HC11 mammary epithelial cell line [30]. We previously generated the HC11/R1 cell line, which is driven by an inducible FGFR1 oncogene when stimulated with a B/B homodimerizer and capable of tumor growth in vivo [34]. We have also recently generated a metastatic variant of these cells using in vivo passaging techniques, termed HC11/R1-LM [32]. Similar to the findings with human cell lines, soluble factors from serum-starved 4T1, B/B-stimulated HC11/R1, and B/B-stimulated HC11/R1-LM cells induced activation of STAT5 in mouse bone marrow derived macrophages (BMDMs) (Fig. 1C). Parental HC11 and solvent-stimulated HC11/R1 and HC11/R1-LM cells failed to activate STAT5, demonstrating that FGFR1 activation in epithelial cells leads to the production of soluble mediators that activate the STAT5 pathway in macrophages. To determine whether activation of STAT5 in macrophages occurs in mammary tumors in vivo, 4T1 cells were injected into the inguinal mammary fat pads of BALB/c mice and tumor sections were co-stained for pSTAT5 and the macrophage marker F4/80. Quantification determined that ~ 31% of F4/80 + cells are also pSTAT5 + (Fig. 1D). These results demonstrate soluble factors produced by human and murine tumor cells activate STAT5 in a subset of macrophages in the tumor microenvironment.

There are multiple avenues through which cell signaling leads to STAT5 activation. GM-CSF is a well-studied canonical activator of STAT5 signaling and is a cytokine that we and others have found to be produced by breast cancer cells [11, 49‐51]. Therefore, we evaluated GM-CSF expression in a subset of the breast cancer cell lines used in Fig. 1. We found high GM-CSF expression in serum-starved Hs578T and MDA-MB-231 TNBC cells compared to MCF7 (ER +), BT-474 (HER2 +), and non-transformed epithelial MCF-10A cells. (Fig. 2A). Assessment of GM-CSF by ELISA revealed elevated concentrations in Hs578T and MDA-MB-231 CM, both of which induced pSTAT5 in macrophages (Fig. 2B). Analysis of GM-CSF production by the HC11, HC11/R1, and HC11/R1-LM cells demonstrated that B/B-treated HC11/R1 and HC11/R1-LM cells induced GM-CSF production (Fig. 2C). We and others have demonstrated that 4T1 cells produce soluble GM-CSF (Fig. 2C) [11, 52]. Further studies were performed to assess the functional contributions of GM-CSF to STAT5 activation in macrophages. Pre-treatment of 4T1-derived and HC11/R1-derived CM with a GM-CSF neutralizing antibody prior to BMDM stimulation led to a significant reduction in pSTAT5 in macrophages (Fig. 2D). These results suggest that tumor cell-derived GM-CSF contributes to STAT5 activation in macrophages.

The immunocompetent 4T1 and HC11/R1 mammary tumor models were selected for further studies to assess the functional consequences of STAT5 activation in TAMs. STAT5-floxed mice were crossed with Csfr1-iCre mice to produce STAT5^fl/fl and STAT5^cKO BALB/c mice [27] and 1 × 10⁴ 4T1 tumor cells were injected into the inguinal mammary glands of the female mice. Isolation of macrophages from mammary tumors demonstrated a reduction in total STAT5 expression in macrophages from STAT5^cKO mice compared with STAT5^fl/fl mice (Fig. 3A). Further characterization of these mice demonstrated no significant differences in the frequency of macrophages within the CD45 + population, although there was a reduction in the total number of macrophages observed in tumors harvested from STAT5^cKO mice compared with STAT5^fl/fl mice (Fig. 3B). Further studies were performed to determine whether myeloid STAT5 deletion led to changes in mammary tumor growth and metastasis. While there were no significant differences observed in primary tumor growth between the two groups of mice (Fig. 3C), we observed a statistically significant increase in lung metastasis in the STAT5^cKO mice compared to the STAT5^fl/fl mice (Fig. 3D). These findings were confirmed using the HC11/R1-LM cells described above. 1 × 10⁴ tumor cells were injected into the mammary glands of STAT5^fl/fl and STAT5^cKO BALB/c mice. Similar to the 4T1 model, there were no significant differences in primary tumor onset, growth rate, or weight at endpoint between STAT5^fl/fl and STAT5^cKO tumor-bearing mice (Fig. 3E, Additional file 1: Fig. S1, S2). However, quantification of metastatic lesions in H&E-stained lungs demonstrated significantly increased metastasis in the STAT5^cKO mice (Fig. 3F). These data indicate that Csfr1-mediated deletion of STAT5 in the myeloid compartment results in enhanced lung metastasis, which suggests STAT5 activation in macrophages may be protective against metastatic progression.

To further explore the enhanced metastasis phenotype observed in STAT5^cKO mice, we sought to determine how STAT5 regulates gene expression in macrophages. STAT5^fl/fl and STAT5^cKO BMDMs were stimulated for 2 h with serum-free medium, recombinant mouse GM-CSF (rmGM-CSF), or 4T1 CM for RNA-seq analysis. Hierarchical clustering of the most variable genes revealed gene expression profiles vary between rmGM-CSF treatment and 4T1 CM. Secondary clustering occurs according to mouse genotype, suggesting differences in transcriptional behavior in stimulated BMDMs from the STAT5^cKO and STAT5^fl/fl mice (Fig. 4A). Gene ontology (GO) analysis determined that genes significantly reduced in rmGM-CSF STAT5^cKO macrophages were associated with recruitment, activation, and response of the adaptive immune system (Fig. 4B). To further investigate macrophage gene expression in the context of the tumor microenvironment, we focused on genes differentially expressed in STAT5^cKO BMDMS when stimulated with 4T1 CM. Similar to the rmGM-CSF treatment, downregulated genes in STAT5^cKO CM-treated macrophages resulted in adaptive immunity-related GO terms such as T cell activation, neutrophil, granulocyte and macrophage migration, and cellular response to IFNɣ (Fig. 4C). Interestingly, we also found upregulated genes in STAT5^cKO BMDMs associated with biological processes such as positive regulation of cell adhesion, negative regulation of immune system processes, regulation of the p38MAPK signaling cascade, and angiogenesis (Fig. 4D). Positive regulation of cell adhesion and angiogenesis processes are typically associated with tumor promotion and tissue remodeling, which can influence cell migration and extravasation events within the metastatic cascade [53]. Using gene set enrichment analysis (GSEA) to more globally identify patterns that otherwise may not be apparent, we found negative enrichment of the IL-2/STAT5 pathway in 4T1 CM-treated STAT5^cKO macrophages which confirms STAT5 activity is effectively diminished (Fig. 4E). GSEA revealed a positive enrichment of multiple cancer-associated pathways such as angiogenesis, hypoxia, glycolysis, and KRAS signaling in STAT5^cKO BMDMs (Fig. 4E). Notably, the epithelial to mesenchymal transition (EMT) gene set was also positively enriched in STAT5^cKO macrophages (Fig. 4F). EMT is critical during the early steps of the metastatic cascade and genes expressed in macrophages associated with this pathway include many ECM factors and genes known to contribute to tissue remodeling, such as Col1a1, Col5a2, Lox, Mmp14, Vcan, Lamc1, and Bgn [54]. In contrast, the IFNɣ response gene set was negatively enriched in STAT5^cKO BMDMs (Fig. 4F) and includes genes involved in co-stimulation (Cd86), leukocyte recruitment (Ccl2, Ccl7, Cxcl10), antigen presentation (Cd74, Psme1, Ciita), and cell growth control (Pim1) [55, 56]. These findings suggest that STAT5 is important for regulating genes associated with adaptive immune responses and that loss of STAT5 leads to increased expression of tumor-promoting genes.

Further studies were performed to validate key genes of interest that are associated with a tumor-promoting phenotype. Collagens are important components of the ECM and are found in abundance in invasive breast cancers [57, 58]. Studies have linked high levels of collagen crosslinking with stromal stiffness and found these tissues harbored the highest number of TAMs and found collagen-expressing TAMs in recurrent tumors [59‐61]. Additional studies have found stromal-produced collagen augments the adhesion capacity of triple-negative MDA-MB-231 cells [62, 63]. Collagen genes were enriched in the EMT gene set from our GSEA analysis, therefore we validated gene expression in rmGM-CSF and 4T1 CM-treated BMDMs from STAT5^fl/fl and STAT5^cKO mice. We found Col1a1 and Col5a2 were significantly upregulated in STAT5^cKO macrophages (Fig. 5A). We also evaluated collagen production by macrophages at the protein level. STAT5^cKO and STAT5^fl/fl BMDMs were stimulated with 4T1 CM for 24 h, then CM was removed and replaced with serum-free media to collect the macrophage-produced soluble factors in what we refer to as double conditioned media (DCM). Using DCM, we performed an ELISA and found that STAT5^cKO BMDMs produced significantly higher concentrations of type I collagen than STAT5^fl/fl macrophages (Fig. 5B). Furthermore, we analyzed STAT5^cKO macrophages for expression of additional tumor-promoting genes including Vegfa, Gpx1, and Bcl6. Vegfa expression stimulates blood vessel formation, which can aid in supplying growth factors and nutrients to support tumor growth and metastasis [50, 64]. Gpx1 (glutathione peroxidase 1) encodes for a cytosolic antioxidant enzyme important for modulating reactive oxygen species in the tumor microenvironment that is elevated in M2-polarized TAMs in breast cancer [65, 66]. Finally, Bcl6 is a gene involved in cell adhesion, negative regulation of the immune response, and inflammation [67, 68] and myeloid-specific deficiency of Bcl6 has been shown to decrease tumor growth and metastasis [69]. These genes were all found to be significantly upregulated in STAT5^cKO BMDMs (Fig. 5A). These results indicate STAT5^cKO macrophages express and produce higher levels of ECM factors and other factors associated with TAM function than STAT5^fl/fl macrophages.

Our data indicate that loss of STAT5 in macrophages results in increased expression of tumor-promoting factors. Macrophage-mediated changes in ECM composition or tissue remodeling factors can drive tumor cell migration, therefore, we hypothesized that STAT5^cKO macrophages directly promote tumor cell metastatic properties such as migration. Focal adhesion kinase (FAK) is a well-known contributor to tumor cell adhesion and invasiveness, and as it is overexpressed in many metastatic tumors [70], it is an attractive anticancer target [66, 71]. The RNA-seq analysis indicates that deletion of STAT5 in macrophages results in increased expression of factors known to activate FAK signaling, such as growth factors (Egf, Vegfa, Ccn2), collagens, and glycoproteins (Tnc) [70, 72]. To discern effects on FAK in tumor cells, we cultured BMDMs in transwells with tumor cells in the lower chamber. This non-contact co-culture system allows for the assessment of changes in tumor cells as a result of soluble factor exchange with STAT5^fl/fl or STAT5^cKO macrophages. 4T1 cells co-cultured with STAT5^cKO BMDMs displayed increased levels of pFAK when compared to 4T1 cells alone or co-cultured with STAT5^fl/fl BMDMs via immunoblotting (Fig. 5C). Because FAK activation is associated with tumor cell migration, further studies were performed to determine whether STAT5^cKO macrophages promote migration. In a transwell migration assay, we observed significantly enhanced tumor cell migration when 4T1 cells were co-cultured with STAT5^cKO macrophages compared to STAT5^fl/fl co-culture (Fig. 5D). These results suggest loss of STAT5 leads to a tumor-promoting expression profile and generates macrophages capable of influencing tumor cell migration.

As an alternative approach to the Csfr1-iCre mice, in which Cre-mediated gene deletion is not limited specifically to TAMs [73], we determined whether co-injection of tumor cells with pre-conditioned macrophages lacking STAT5 would be sufficient to enhance tumor cell aggressiveness and metastatic potential. In this experiment, BMDMs isolated from STAT5^fl/fl and STAT5^cKO mice were pre-treated with 4T1 CM and then co-injected with 1 × 10⁴ tumor cells at a ratio of 1:4. Primary tumor growth and lung metastasis were assessed as described above. 4T1 cells co-injected with STAT5^cKO macrophages reached tumor size endpoint faster, demonstrating enhanced primary tumor growth compared with 4T1 cells co-injected with STAT5^fl/fl macrophages (Fig. 5E). Consistent with our hypothesis, we also found significantly enhanced lung metastasis in mice co-injected with 4T1 tumor cells and STAT5^cKO TAMs (Fig. 5F). Taken together, these studies indicate that loss of STAT5 expression in TAMs leads to enhanced tumor metastasis.