Introduction
Materials and methods
Patients
Criteria for the diagnosis of classic KD
Inclusion criteria
Exclusion criteria
Data collection
Experimental method
Gene | Primer sequence (5’ → 3’) |
---|---|
ATG16L1 | F: 5'- AACGCTGTGCAGTTCAGTCC-3' |
R: 5'- AGCTGCTAAGAGGTAAGATCCA-3' | |
BECN1 | F:5'- CCATGCAGGTGAGCTTCGT-3' |
R:5'- GAATCTGCGAGAGACACCATC -3' | |
P62 | F: 5'- GCACCCCAATGTGATCTGC-3' |
R:5'- CGCTACACAAGTCGTAGTCTGG-3' | |
LAMP2 | F: 5'-GAAAATGCCACTTGCCTTTATGC-3' |
R: 5'-AGGAAAAGCCAGGTCCGAAC-3' | |
LC3II | F:5'-GATGTCCGACTTATTCGAGAGC-3' |
R: 5'-TTGAGCTGTAAGCGCCTTCTA-3' | |
GADPH | F:5'-GGTGAAGGTCGGAGTCAACGG-3' |
R:5'-GGTCATGAGTCCTTCCACGATCATACC-3' |
Statistical analysis
Results
Demographic features | IVIG-sensitive (n = 108) | IVIG-resistant (n = 31) | Z/χ2 | P |
---|---|---|---|---|
Gender (M/F) | 67/41 | 20/11 | 0.063 | 0.801 |
Age (year) | 3.01 (1.64,4.35) | 2.8 (1.82,3.86) | -0.941 | 0.347 |
Height (cm) | 96 (83.25,110) | 92 (83,104) | -0.681 | 0.496 |
Weight (kg) | 14 (11,17.88) | 14 (11.5,16) | -0.388 | 0.698 |
Comparison of laboratory parameters between the IVIG-sensitive group and the IVIG-resistant group
Variable(s) | IVIG-sensitive(n = 108) | IVIG-resistant (n = 31) | Z/χ2 | P |
---|---|---|---|---|
Fever before IVIG | 5(5,7) | 5(4,6) | -1.872 | 0.061 |
Length of hospitalization | 5(4,6) | 7(6,9) | 4.934 | < 0.001* |
Stiffness of hands | 73/108 | 21/31 | 0 | 0.998 |
Rash | 36/108 | 11/31 | 0.05 | 0.823 |
Enlarged lymph nodes | 24/108 | 11/31 | 2.249 | 0.134 |
Conjunctival congestion | 95/108 | 28/31 | 0.132 | 0.717 |
Strawberry tongue | 96/108 | 29/31 | 0.577 | 0.447 |
Perianal peeling | 56/108 | 22/31 | 3.574 | 0.059 |
CAL | 9/108 | 7/31 | 3.503 | 0.061 |
Variable(s) | IVIG-sensitive (n = 108) | IVIG-resistant (n = 31) | Z | P |
---|---|---|---|---|
WBC(× 10^9/L) | 10.96(8.17,15.57) | 13.38(8.09,15.79) | 0.806 | 0.42 |
HB(g/L) | 109(100,117) | 100(90,114) | -2.787 | 0.005* |
PLT(× 10^9/L) | 358(269,439) | 296(267,440) | -0.548 | 0.583 |
RBC(× 10^9/L) | 3.98(3.75,4.33) | 3.77(3.54,3.98) | -3.112 | 0.002* |
N% | 66.8(50.4,78.8) | 66.7(52.4,82.6) | 0.536 | 0.592 |
L% | 23.8(14.5,36.6) | 25.2(11.3,36.5) | -0.439 | 0.661 |
MO% | 5.4(3.9,7.5) | 6.3(3.3,8) | -0.018 | 0.986 |
EOS% | 0.18(0.06,0.43) | 0.12(0.03,0.35) | -1.094 | 0.274 |
ALT (U/L) | 18(9.25,40.5) | 24(15,108) | 2.04 | 0.041* |
AST (U/L) | 26(20,40) | 48(29,63) | 3.394 | 0.001* |
PA (mg/L) | 82.1(51.28,111) | 65.8(34.8,108.8) | -1.045 | 0.296 |
ALB (g/L) | 38.95(34.5,41.58) | 34.2(32.3,38.6) | -3.36 | 0.001* |
GLB (g/L) | 23.1(19.73,25.93) | 24.4(20.6,38.9) | 2.168 | 0.03* |
A/G | 1.7(1.4,2) | 1.4(0.8,1.8) | -3.232 | 0.001* |
TP (g/L) | 61.75(57.25,66.9) | 59.8(56.2,70) | 0 | 1 |
r-GT(U/L) | 14.5(9,59) | 38(19,100) | 2.592 | 0.01* |
DBIL (μ mol/L) | 3.05(2.2,4.38) | 2.7(2,21.2) | 0.245 | 0.806 |
TB (μmol/L) | 7.85(4.83,10.15) | 6.6(3.7,31.2) | -0.104 | 0.917 |
ALP(U/L) | 162(129.25,207.75) | 179(135,227) | 1.151 | 0.25 |
NA (mmol/L) | 136.05(134,138.53) | 134.85(133.8,137.13) | -1.135 | 0.189 |
CK(U/L) | 51(32.25,88.5) | 31(25,53) | -2.69 | 0.007* |
CK-MB (U/L) | 24(17,35.5) | 22(17,34) | 0.514 | 0.607 |
LDH(U/L) | 285.5(239.5,384.5) | 290(224,414) | -0.243 | 0.808 |
LDH-1 (U/L) | 53(46,70) | 57(43,76) | 0.581 | 0.561 |
K(mmol/L) | 4.45(3.8,4.8) | 3.99(3.71,4.99) | -0.867 | 0.386 |
IgA(g/L) | 0.79(0.52,1.34) | 0.97(0.54,1.35) | 0.663 | 0.507 |
IgM(g/L) | 0.99(0.75,1.24) | 0.95(0.8,1.57) | 0.66 | 0.509 |
IgG(g/L) | 7.46(5.84,10.08) | 8.07(7.18,20) | 2.378 | 0.017* |
C3(g/L) | 1.26(1.03,1.44) | 1.24(1.11,1.53) | 1.05 | 0.294 |
C4(g/L) | 0.27(0.21,0.34) | 0.24(0.2,0.28) | -1.485 | 0.138 |
CD3 + T(/μL) | 1475(727.75,2230.75) | 1321(720.5,3213) | 0.743 | 0.457 |
CD3 + CD4 + CD8 + T (/μ L) | 3(1,7) | 4(1,10.5) | 1.31 | 0.19 |
NK (/μ L) | 162(85.25,323) | 133.5(69.25,307.5) | -0.83 | 0.407 |
CD3 + CD8 + T (/μ L) | 435.5(270.25,743) | 534(228,981.5) | 0.726 | 0.468 |
CD19 + B% | 48.81(28.97,773) | 70.48(34.26,661) | 0.681 | 0.496 |
CD3 + CD8 + T% | 18.29(13.82,22.5) | 16.79(14.86,22.75) | 0.334 | 0.738 |
CD3 + CD4 + T% | 32.12(26.71,40.32) | 37.34(25.37,42.9) | 1.103 | 0.27 |
CD3 + CD4 + CD8 + T% | 0.12(0.04,0.22) | 0.16(0.07,0.26) | 1.304 | 0.192 |
NK% | 6.99(4.06,11.07) | 6.15(3.92,9.19) | -1.097 | 0.273 |
ESR (mm/h) | 51(20,78) | 83.5(24,91) | 2.826 | 0.005* |
CRP (mg/L) | 85.4(45.1,125) | 75.9(33.98,126.25) | 0.812 | 0.417 |
SF (ng/ml) | 161.78(125.11,240.02) | 175.47(123.9,323.64) | 1.232 | 0.218 |
PCT (ng/mL) | 0.92(0.36,2.57) | 1.22(0.43,8.74) | 2.252 | 0.024* |
IL-2(pg/ml) | 2.44(1.35,3.65) | 3.04(1.4,3.91) | 1.193 | 0.233 |
IL-4(pg/ml) | 2.63(1.65,3.43) | 3.1(1.82,3.93) | 1.75 | 0.08 |
IL-6(pg/ml) | 58.79 (21.72,145.6) | 211.39(87.32,294.19) | 1.827 | 0.068 |
IL-10(pg/ml) | 10.53(5.98,25.31) | 15.58(5.45,57.76) | 0.315 | 0.753 |
TNF-α(pg/ml) | 3.52(2.39,5) | 3.64(2.44,5.7) | 0.706 | 0.48 |
Comparison of expression of autophagy markers
Variable(s) | IVIG-sensitive (n = 108) | IVIG-resistant (n = 31) | Z | P |
---|---|---|---|---|
ATG16L1 | 0.49 (0.42,0.61) | 0.41 (0.34,0.50) | 3.095 | 0.002* |
BECN1 | 0.83 (0.66,1) | 0.46 (0.41,0.62) | 5.772 | < 0.001* |
LC3II | 0.71 ± 0.19 | 0.41 ± 0.21 | 6.930 | < 0.001* |
LAMP2 | 0.7 (0.58,0.81) | 0.79 (0.52,1.03) | 0.906 | 0.365 |
p62 | 1.09 ± 0.48 | 1.04 ± 0.68 | 0.433 | 0.666 |
Correlation analysis of autophagic markers with clinical indices
Items | BECN1 | |
---|---|---|
P | r | |
Groups | 0.000 | -0.491 |
Length of hospitalization | 0.002 | -0.256 |
Enlarged lymph nodes | 0.019 | -0.2 |
Perianal peeling | 0.008 | -0.225 |
IL-4 | 0.018 | -0.202 |
IL-6 | 0.007 | -0.228 |
CRP | 0.012 | -0.212 |
RBC | 0.003 | 0.249 |
HB | 0.003 | 0.248 |
CK | 0.013 | 0.21 |
CK-MB | 0.039 | 0.175 |
CD3 + CD4 + T | 0.031 | -0.187 |
CAL | 0.000 | -0.343 |
ALB | 0.004 | 0.241 |
A/G | 0.031 | 0.183 |
r-GT | 0.003 | -0.247 |
PCT | 0.013 | -0.258 |
SF | 0.015 | -0.224 |
LC3II | 0.006 | 0.231 |
ATG16L1 | 0.01 | 0.217 |
Items | LC3II | |
---|---|---|
P | r | |
Groups | 0.000 | -0.500 |
Length of hospitalization | 0.000 | -0.364 |
Enlarged lymph nodes | 0.018 | -0.201 |
CAL | 0.002 | -0.262 |
IgG | 0.046 | -0.178 |
BECN1 | 0.006 | 0.231 |
Independent risk factors for IVIG resistant KD
Items | B | SE | Wal | Df | P | Exp(B) (95%CI) |
---|---|---|---|---|---|---|
Length of hospitalization | 0.346 | 0.092 | 14.215 | 1 | 0.000 | 1.41 (1.18,1.69) |
HB | -0.54 | 0.018 | 9.471 | 1 | 0.002 | 0.95 (0.92,0.98) |
RBC | -1.901 | 0.588 | 10.442 | 1 | 0.001 | 0.15 (0.05,0.47) |
ALT | 0.003 | 0.003 | 1.041 | 1 | 0.308 | 1 (1,1.01) |
AST | 0.006 | 0.004 | 2.881 | 1 | 0.090 | 1 (1.00,1.01) |
ALB | -0.138 | 0.043 | 10.58 | 1 | 0.002 | 0.87 (0.80, 0.95) |
GLB | 0.096 | 0.028 | 12.037 | 1 | 0.001 | 1.10 (1.04, 1.16) |
A/G | -1.118 | 0.527 | 12.788 | 1 | 0.000 | 0.15 (0.05,0.42) |
r-GT | 0.002 | 0.003 | 0.794 | 1 | 0.373 | 1.00 (1.00, 1.01) |
CK | -0.015 | 0.007 | 5.045 | 1 | 0.025 | 0.99 (0.97,0.99) |
ESR | 0.02 | 0.007 | 8.058 | 1 | 0.005 | 1.02 (1.01,1.04) |
PCT | 0.034 | 0.035 | 0.938 | 1 | 0.333 | 1.03 (0.97, 1.11) |
IgG | 0.129 | 0.037 | 12.126 | 1 | < 0.001 | 1.14 (1.06,1.22) |
ATG16L1 | -5.092 | 1.613 | 9.972 | 1 | 0.002 | 0.006 (0, 0.145) |
BECN1 | -5.655 | 1.17 | 23.346 | 1 | < 0.001 | 0.004 (0,0.035) |
LC3II | -7.262 | 1.427 | 25.894 | 1 | 0.001 | 0.001 (0,0.002) |
Predictive modeling
Items | Cutoff | Point | OR (95%CI) | P |
---|---|---|---|---|
ESR | 79.5 | 1 (> = 79.5), 0(< 79.5) | 20.37 (3.737,111.044) | < 0.001 |
BECN1 | 0.645 | 1 (< = 0.645), 0(> 0.645) | 15.766 (4.291,57.993) | < 0.001 |
LC3II | 0.481 | 2 (< = 0.481), 0(> 0.481) | 41.61 (7.764,223.006) | < 0.001 |