Background
Breast cancer is the most commonly diagnosed cancer worldwide, and it is the first leading cause of cancer-related death in women [
1]. Based on the expression status of the estrogen receptor (ER-a), progesterone receptor (PR) and human epidermal growth factor 2 receptor (HER2/ERBB2), breast cancer is classified as luminal A, luminal B, HER2 positive and TNBC [
2]. TNBC is characterized by the absence of the three targetable receptors, and thus, patients of TNBC show low chemotherapy response and poor outcome [
3].
MicroRNAs are small non-coding RNA which mostly combine the 3’ untranslated region (UTR) or rarely combine the 5’UTR of a target mRNA to regulate post-transcriptional modification and mediate cancers’ apoptosis, proliferation and so on [
4]. MiR-26a-5p, also called miR-26a-1, has been previously demonstrated that it plays an anti-oncogene role in tumor’s tumor proliferation, metastasis and apoptosis, such as renal cell carcinoma, hepatocellular carcinoma, gastric cancer and breast cancer [
5‐
8]. However, the underlying mechanism of the miR-26a-5p in DNA damage repair has not yet been explored.
Cisplatin is the first generation of platinum drug which interacts with both intra- and inter-strand DNA cross-links (ICLs) to stall replication forks to kill cancer cells [
9]. ICLs triggers a complex intracellular signal transduction cascade to active DDR to repair the lesions including single-strand DNA (ssDNA) errors and double-strand breaks (DSBs), such as nucleotide excision repair (NER), mismatch repair (MMR), homologous recombination (HR) and non-homologous end joining (NHEJ) [
10‐
12]. DSBs are the most dangerous among all types of DNA damage. Notably, the HR repair (HRR) pathway is a highly conserved manner that ensure the accurate repair of DSBs by using the intact sister chromatid as a template for repair, thereby maintaining the sequence integrity [
13]. Therefore, the dysfunction of HR-related genes lead to genomic instability, which is a hallmark of cancer [
14].
BARD1, the chaperone of BRCA1 translocation into and retention in the nucleus, is an E3 ubiquitin-protein ligase essential for BRCA1 stability. ATM kinase phosphorylated BRCA1 is recruited to DNA damage sites and then binds with the BARD1 to form BARD1-BRCA1complex [
13,
15]. The complex, the key component of HR, plays a vital role in the DSB repair [
16]. NABP1, a member of single-stranded DNA binding proteins (SSBs) also called hSSB2 or OBFC2A, is the close homolog of hSSB1 which stimulates the activity of RAD51 recombinase and/or by recruiting RAD51, a biomarker of HRR, to the lesions. They form different hSSB complexes which are required for HR-dependent DNA repair and maintenance of genome stability [
17‐
19]. H2AX is phosphorylated by ATM kinase at sites of DNA lesions as γH2AX, a marker of DNA damage, enabling DNA repair proteins are recruited to DNA damage sites [
20]. Ultimately, if DDR fails to remove the lesions, the specific DNA lesions formed blockage of DNA replication which leads to the collapse of replication forks will trigger apoptosis [
21,
22].
The lack of effective chemotherapies has forested a major effort to discover more targetable molecular targets to treat TNBC exactly as synthetic lethality [
23]. For example, germline BRCA1/2 mutations (gBRCAm) or ‘BRCAness’ result in HR deficiency making the tumors sensitive to poly-(ADP ribose)-polymerase inhibitors (PARPis) because they have a specific type of DNA repair defect. PARPis cause persistent SSBs which potentially create DSBs if they encountered by replication forks then resulting in the collapse of the forks. PARP1is trap PARP1 on DNA, preventing autoPARylation and PARP1 release, therefore arresting the catalytic cycle of PARP1. The greater efficiency of inhibiting PARP-mediated repair of DNA damage induced by chemotherapy or radiotherapy could be achieved [
24]. It has been revealed that PARP1is play important roles in DDR, transcriptional regulation and cell apoptosis and exhibited huge potency in cancer therapy. So far, there were four PARPis approved for the treatment of several cancers, including Olaparib. Recent studies have significantly broadened the concept of BRCAness that it is not only a defect in mimicking BRCA1 or BRCA2 loss but also defects in HRR, replication fork protection and the subsequent hypersensitivity to DNA damaging agents. BRCAness is used to predict responses to agents as PARP1is or platinum-based salts in patients without gBRCAm [
25‐
27].
ER-a and PR belong to the nuclear receptor family and play diverse roles in biological processes via transcriptional regulating [
28]. In breast cancer, the two receptors are biomarkers for classification and targets for endocrine therapy. However, whether the loss of the two genes affects the expression of downstream genes that participate in the progress of TNBC remains unknown.
In this study, we demonstrated that miR-26a-5p acts as BRCAness via negatively regulating BARD1/NABP1 and providing a potential therapeutic strategy. Besides, we explored the mechanism that miR-26a-5p is especially downregulated in TNBC.
Methods
miRNA-seq analysis
The miRNA-seq data of breast cancer were downloaded from The Cancer Genome Atlas (TCGA). The packages of GDCRNATools, LIMMA, edgeR and ggplot2 for R were used to analyze miRNA-seq data.
Clinical samples
Total 51 paired samples of human breast cancer tissue and their matched adjacent normal tissue were collected from Wuhan Union Hospital, Tongji medical college, Huazhong University of Science and Technology (Wuhan, China), between 2016 and 2019.
Cell culture
MCF-7 and 293T cell lines were cultured in DMEM supplemented with 10% fetal bovine serum (FBS). T47D, BT549, MDA-MB-468, BT474 cell lines were cultured in Roswell Park Memorial Institute-1640 (RPMI-1640, Gibco) supplemented with 10% FBS. BT20 cells were cultured in MEM (Gibco) supplemented with extra 1% non-essential amino acid (NEAA) and 10% FBS. MCF10A cells were cultured in DMED/F12 supplemented with extra 10 µg/ml insulin, 20 ng/ml epidermal growth factor (EGF), 100 µg/ml cholera toxin, 0.5 µg/ml hydrocortisone and 5% FBS. The above cell lines were all cultured in 5%CO2 environment. MDA-MB-231 cell lines were cultured in L15 supplemented with 10% FBS in a CO2 free environment.
RNA extraction and RT-qPCR
Total RNA was obtained with RNAiso for Small RNA regent (Takara) from cell lines and frozen fresh tissue. cDNAs were reverse transcribed with PrimeScript™ RT reagent Kit (Takara). RT-qPCR was performed with the TB Green® Premix Ex Taq™ (Takara) on the Bio-Rad CFX96 Touch Deep Well Real-Time PCR Detection System. Specific primer pairs of miRNA-26a-5p were purchased from RiboBio (Guangzhou, China). And relative expression values for miRNA-26a-5p were obtained by normalizing to the expression of U6 gene using the ΔΔCt method.
Transfection
The miR-26a-5p mimic and siRNA for NABP1 were purchased from RiboBio (Guangzhou, China). The shRNAs for BARD1 and overexpressing plasmids for BARDA, NABP1, ER-a, PR were purchased from GENECHEN (Shanghai, China). Cells were transfected with siRNA, plasmids and mimic using Lipofectamine 3000 reagent (Invitrogen) according to the protocol.
CCK8 assay
Cells were seeded in 96-well plates at 2500–3000 cells per well and treated with different concentrations of Cisplatin (Selleck) with medium containing 1% FBS. After 72 h of treatment, Cell Counting Kit-8 (CCK8, Bimake) was added at one-tenth of the volume of the wells’ medium. After 2 h, the OD value of per well was measured at 450 nm with a Bio-Rad iMark spectrometer.
Comet assay
Alkaline comet assays were performed to detect both single-strand break (SSB) and double-strand break (DSB). According to the quick protocol, 500 µl of low melt agarose (LMAgarose) was added to 5000 cells in 50 µl of PBS and pipetted onto Trevigen® comet slides. Once gel had solidified, slides were incubated in lysis solution overnight at 4 °C. After incubated in 4 °C for 1 h with alkaline unwinding solution (0.6 g NaOH, 250 µl 200 mM EDTA, 49.75 ml ddH2O), electrophoresis was performed for 30 min at 23 V in alkaline electrophoresis solution (300 mM NaOH, 1 mM EDTA). After washes, slides were stained with 100 µl 0.01% SYBR®Gold. Fifty cells from each condition were evaluated with the CASP Comet analysis system from pictures obtained with an electron fluorescence microscope.
Immunofluorescence
The treated cell slides were washed with PBS in the culture plate, then fixed with 4% paraformaldehyde for 15 min and permeabilized with 0.5% Triton X-100 at room temperature for 20 min after washing with PBS. After washing 3 times with PBS, normal goat serum was added to the glass slides and blocked at room temperature for 30 min. The blocking solution was removed by absorbent paper, and then, the primary antibody was added dropwise. And the cells were incubated at 4 °C overnight. Incubate the fluorescent secondary antibody under the dark condition at room temperature for 1 h or 37 °C for 30 min. After washing with PBS, add DAPI and incubate in the dark for 5 min to stain the specimen. Block slides with mounting fluid containing anti-fluorescence quencher. Finally, the collected images were observed under a fluorescence microscope.
Luciferase reporter assay
The BARD1 3’UTR and NABP1 3’UTR (WT) or mutant (MUT) plasmids were purchased from RiboBio (Guangzhou, China). The luciferase reporter assay was performed with the Dual-Glo® Luciferase Assay System (Promega) according to the protocol.
Flow cytometric analysis
Cells were plated 24 h prior to treatment with Cisplatin. After treatment, medium was collected separately to stop the reaction of free-EDTA trypsin and cells. All cells were collected. After washes with PBS, 500 µl binding buffer resuspended the cells per cube. After incubated with 5 µL Annexin-V FITC and 5 µl 7-ADD in the dark environment at room temperature for 5–15 min, flow cytometry detection was performed.
Western blot analysis
SDS–polyacrylamide gel electrophoresis was performed using 12% bis–tris gels (Biosharp), and proteins were transferred to PVDF membranes by semidry transfer using Trans-Blot transfer medium (Bio-Rad). Membranes were blocked in 5% skimmed milk in TBS-T and incubated overnight at 4 °C with primary antibodies, including γH2AX (#7918, Cell Signaling Technology), Caspase-3 (#14220, Cell Signaling Technology), Caspase-9(#9508, Cell Signaling Technology), Bax (#5023, Cell Signaling Technology), Bcl-2(#15071, Cell Signaling Technology), ER-a (#8644, Cell Signaling Technology), PR (#8757, Cell Signaling Technology), RAD51(14961-1-AP, Proteintech), Fas (ab133619, Abcam), FADD (ab124812, Abcam).
Hormone deprivation and stimulation assay
T47D and MCF-7 cell lines were cultured in phenol red-free RPMI-1640 (BOSTER, China) or phenol red-free DMEM (BOSTER, China) supplemented with 10% dextran charcoal-stripped bovine serum (Biological Industries, China) for 48 h. After hormone deprivation, β-Estradiol (E2, Sigma, E2758) or Etonogestrel (Selleck, S4673) was added to the free-hormone medium in different concentrations for next cell culture.
ChIP assay
Chromatin immunoprecipitation assays were performed with SimpleChIP® Plus Enzymatic Chromatin IP Kit (Cell Signaling Technology). Immunoprecipitation was performed with anti-ER-a (#8644, Cell Signaling Technology) and anti-PR antibodies (#8757, Cell Signaling Technology). Specific regions were quantified via qRT-PCR using the primers:
PR Bindsite: Sense primer 5′–AGGCTGAGGAGGCACTTTGT–3′, Anti-sense primer 5′–AGTGGGCATTTTCGGGTG–3′.
ER-a Bindsite1: Sense primer 5′–CCCTTCCGAATCCTTCCAGTG–3′, Anti-sense primer 5′–TCGCCTGGTGGGGGAGA–3′;
Bindsite2: Sense primer 5′–CTCTGCCGTCCGCTACACC–3′, Anti-sense primer 5′–GGAAGGAGAAAGGAAGGGAGG–3′;
Bindsite3: Sense primer 5′–CGCCCTCGCTCGCTCCTT–3′, Anti-sense primer 5′–GCCCCCCGCAAGCCAA–3′.
Viral infection and animal experiments
To obtain stable miRNA-26a-5p-expressing MDA-MB-231 cell line for in vivo study, cells were infected with hU6-MCS-EGFP-miRNA-26a-5p lentivirus (GENECHEM, China). Four-week-old female BALB/c nude mice were purchased from Vital River for the in vivo study. The mice were injected subcutaneously around their second mammary gland with 1 × 107 cells in 100 µl free-FBS L15 mixed with 100 µl Matrigel matrix (Corning, #354234). Tumor volume (TV) (mm3) = L × W2 × π/6 , where L is the length and W is the width. Relative tumor volume (RTV) = Vt/V0, where Vt is the recorded volume after treatment and V0 at the start of treatment. The relative tumor growth inhibition T/C ratio is used to evaluate the efficacy of drugs in tumor xenograft experiments by the following formula: T/C% = Treatment-RTV/Control-RTV × 100%. Cisplatin (2.5 mg/kg) or ddH2O was peritoneal injected when one group’s volume exceeded 150 mm3.
Statistical analysis
All data are presented as mean values ± SD. And all the statistical analyses were performed using SPSS software. The differences were assessed using two-tailed Student’s t test for group comparisons. All in vitro experiments were conducted three times. Differences were considered significant when P value was less than 0.05. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001 versus control. N.S. not significant.
Discussion
Tumor heterogeneity and lack of effective treatment result in the worst outcomes of TNBC. Researches on tumor microenvironment and tumor immunity bring new strategy insights to TNBC therapy. However, chemotherapy remains the most important systemic treatment and the optimal integration of platinum drugs is still a controversial issue [
41]. HRR plays a vital role in DDR, and the pathway-related genes could be the targets to invent innovative drugs. BARD1 cooperates with BRCA1 to form a heterodimer complex, triggering DSBs into the HR pathway for damage repair [
42]. NABP1, a homolog of hSSB1, has been reported to play a role in the HR-dependent repair of DSBs [
17]. Our results confirmed that miR-26a-5p impaired HRR by negatively regulating BARD1 and NABP1. A new definition of BRCAness revealed that it formed HRD, thus sensibilizing to DNA damaging agents and PARPis, ultimately leading to synthetic lethality with PARPis [
25]. PARP1is inhibit DNA repair through PARP1 trapping, thus promoting sensitivity of radiotherapy and chemotherapy drugs. Besides, in BRCA-mutated cancers, the deficient of PARP1 could lead to synthetic lethality. Phase 3 OlympiA clinical trial for Olaparib has demonstrated that patients with germline BRCA1 or BRCA2 pathogenic or likely pathogenic variants could obtain a benefit in early breast cancer [
43]. To further illustrate miR-26a-5p acts as BRCAness, we verified its sensibilization about Olaparib, a PARP1 inhibitor. Therefore, the miR-26a-5p/BARD1/NABP1 axis may alter HRR function to some degree and result in BRCAness with enhanced genomic instability, leading to the sensitivity to Cisplatin, Olaparib and their combination. Interestingly, in our study, we found that MDA-MB-231 and BT549 showed significantly different sensitivity to Olaparib and reversed to Cisplatin. Both cell lines are BRCA1/2 wild TNBC cell lines. However, MDA-MB-231 exhibits more sensitivity to Olaparib than BT549. It may suggest that there are stronger regulators expect BRCA1 or BRCA2 to modulate response to Olaparib. Next step, we will explore more potential molecular for PARPis therapy.
Recent studies have revealed the emerging role of miRNAs in cancer treatment, such as involvement in the tumor immune escape and interaction with TME. In addition, miRNAs’ dysregulation participates in the regulation of DDR and drugs’ response. For instance, the miR-302 family is reported that they enhance breast cancer cells’ sensitivity to radiotherapy [
44]. It is worth noting that the third medical revolution led by nucleic acid drugs is getting increasingly hot. Epigenetic modifications include miRNAs regulation rising as a new direction of cancer therapy. Therefore, miRNA-based therapeutics via targeting oncomiRNAs or restoring anti-oncomiRNAs are innovative. According to P. Mondal et al. review, there are numerous anti-miRNAs and miRNA mimics related to cancer under preclinical studies or clinical trials [
45]. For example, MesomiR-1, a mimic of miR-16, is packed in EDV™ nanocells to target EGFR. It has been demonstrated that MesomiR-1 exhibited well in Phase I [
46]. Apart from that, Wenqiang Yu et al. hold the view that reactive dysfunction of tumor suppressor genes by enhancer switching through NamiRNA network may be a potential treatment strategy [
47]. In our research, we found that miR-26a-5p promoted Cisplatin sensitivity for the first time. In vivo, we demonstrated that miR-26a-5p overexpression inhibited tumor growth and improved the curative effect of Cisplatin. Hence, miR-26a-5p is a potential target to achieve miRNA-based therapeutics. Although limitations in miRNA-based therapeutics are their physicochemical characteristics which influence their efficiencies, chemical modification of miRNAs and innovative delivery methods may expand the application of the therapy.
Cisplatin-induced cell death remains several steps: Firstly, it causes DDR. Then, mitochondrial outer membrane permeabilization would trigger intrinsic apoptosis and other components of the extrinsic apoptotic pathway [
11]. Fas receptor-dependent pathway and mitochondrial-dependent pathway have been verified to take part in Cisplatin-induced cell death. It has been reported that Cisplatin promotes Fas death receptor pathway apoptosis independent of Fas ligand in human colon cancer cells. It suggested that chemotherapeutic agents could activate the Fas receptor and recruit FADD [
48]. In our research, we found that miR-26a-5p promotes Cisplatin-induced apoptosis both in the mitochondrial-dependent pathway and Fas death receptor pathway. Interestingly, miR-26a-5p could enhance the expression of Fas under normal situations. It indicated that miR-26a-5p may build a hypersensitivity of the Fas death receptor state. However, MMR defects and other DDR defects induce the expression of FAS, FASL and TRAILR death receptors at the tumor cell surface [
49]. It suggested that miR-26a-5p could regulate Fas expression via other DDR defects. It possibly brings a deeper insight into the function of miR-26a-5p.
Dysregulation of gene expression usually happens at the following levels: gene mutation, transcriptional regulation, post-transcriptional regulation, translational regulation and post-translational regulation. In this study, we found that miR-26a-5p is downregulated in breast cancer, especially in TNBC. To figure out the upstream factors downregulating miR-26a-5p in TNBC, we assumed it correlated with ER-a and PR status. ChIP assay confirmed that ER-a and PR regulate its expression in at the transcriptional level. However, it needs further study to investigate whether other mechanism, as DNA promoter methylation or gene mutation, involves in regulation of miR-26a-5p.
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.